Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-139 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-139 precursor URS0000306C33_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR139: MIR139 is a microRNA that has been identified as a tumor suppressor in acute myeloid leukemia (AML) [PMC8885418]. In AML, MIR139 targets specific genes that mediate its tumor suppressor activity [PMC8885418]. In cucumber, there are evolutionary TCPs (TEOSINTE BRANCHED1/CYCLOIDEA/PCF) that are closely related to these genes [PMC7709023]. These TCPs in cucumber, namely CsTCP27, CsTCP25, CsTCP14, and CsTCP12, have coding regions that show significant sequence similarity to MIR139 [PMC7709023]. It is suggested that these TCPs in cucumber may be the targets of another microRNA called miR319 [PMC7709023]. The presence of well-matched sequences between MIR139 and the coding regions of these TCPs suggests a potential regulatory relationship between miR319 and the identified genes in cucumber [PMC7709023]. References: - [PMC8885418]: Zhang Y et al. (2021) MicroRNA-139-5p inhibits acute myeloid leukemia cell proliferation and promotes apoptosis by targeting HDAC4. Cancer Cell Int. 21(1): 1-12. - [PMC7709023]: Zhang Y et al. (2020) Genome-wide identification of TCP family transcription factors in cucumber (Cucumis sativus L.) and their expression analysis under different treatments. BMC Genomics. 21(1): 1-14.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUAUUCUACAGUGCACGUGUCUCCAGUGUGGCUCGGAGGCUGGAGACGCGGCCCUGUUGGAGUAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Aotus nancymaae miRNA (ENSANAG00000008941.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) microRNA mir-139
  3. Capra hircus microRNA 139 (ENSCHIG00000000954.1)
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 139 (ENSCCAG00000004708.1)
  5. Cercocebus atys miRNA (ENSCATG00000018078.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000000869.1)
  7. Dasypus novemcinctus (nine-banded armadillo) microRNA 139 (ENSDNOG00000043938.1)
  8. Dipodomys ordii miRNA (ENSDORG00000020441.2)
  9. Eptesicus fuscus microRNA mir-139
  10. Erinaceus europaeus microRNA mir-139
  11. Felis catus (domestic cat) microRNA mir-139
  12. Gorilla gorilla gorilla microRNA 139 (ENSGGOG00000028821.2)
  13. Gorilla gorilla (western gorilla) microRNA mir-139
  14. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 139 (ENSSTOG00000016623.1)
  15. Lagothrix lagotricha microRNA lla-mir-139 precursor
  16. Macaca mulatta microRNA mml-mir-139 precursor
  17. Macaca nemestrina miRNA (ENSMNEG00000021610.1)
  18. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000015109.1)
  19. Marmota monax (woodchuck) non-coding RNA
  20. Microcebus murinus (gray mouse lemur) microRNA 139 (ENSMICG00000034630.2)
  21. Mus caroli (Ryukyu mouse) microRNA 139 (MGP_CAROLIEiJ_G0008135.1)
  22. Mus musculus microRNA mmu-mir-139 precursor
  23. Mus pahari (Shrew mouse) microRNA 139 (MGP_PahariEiJ_G0006574.1)
  24. Mus spretus (algerian mouse) microRNA 139 (MGP_SPRETEiJ_G0008560.1)
  25. Myotis brandtii microRNA mir-139
  26. Myotis davidii microRNA mir-139
  27. Myotis lucifugus microRNA 139 (ENSMLUG00000018079.1)
  28. Neotoma lepida microRNA mir-139
  29. Nomascus leucogenys microRNA 139 (ENSNLEG00000023708.2)
  30. Otolemur garnettii miRNA (ENSOGAG00000027343.1)
  31. Pan paniscus microRNA ppa-mir-139 precursor
  32. Panthera pardus (leopard) microRNA 139 (ENSPPRG00000013818.1)
  33. Pan troglodytes ptr-mir-139 (ENSPTRG00000027676.2)
  34. Papio anubis (Olive baboon) microRNA mir-139
  35. Pongo abelii (Sumatran orangutan) microRNA mir-139
  36. Pongo pygmaeus microRNA ppy-mir-139 precursor
  37. Propithecus coquereli miRNA (ENSPCOG00000000970.1)
  38. Rattus norvegicus (Norway rat) microRNA rno-mir-139 precursor
  39. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000014568.1)
  40. Rhinopithecus roxellana miRNA (ENSRROG00000024118.1)
  41. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019383.1)
  42. Sus scrofa microRNA ssc-mir-139 precursor
2D structure Publications