Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 45B (SNORD45B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 45B (SNORD45B) URS00002F8E76_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD45B: SNORD45B is a small nucleolar RNA (snoRNA) that is differentially expressed in various tissues and diseases. It has been identified as one of the common genes expressed in both placentas and mammary glands (MGs) [PMC7174383]. In a study on myocardial infarction (MI), the expression of SNORD45B was found to be decreased on the first day of MI and increased thereafter [PMC10020602]. SNORD45B has been identified as one of the most stably expressed genes among five potential reference genes [PMC5865145]. It is a canonical snoRNA predicted to guide 2'-O-ribose methylation at U172 of 18 S rRNA [PMC5865145]. In patients with coronary artery disease, SNORD45B expression levels were found to be unaffected by RA treatment and had no significant difference between plaques and adjacent intima [PMC9046892]. However, in kidney renal clear cell carcinoma (KIRC), SNORD45B was significantly upregulated in tumor tissues compared to adjacent normal tissues, and patients with higher expression levels had worse overall survival [PMC7313177]. Additionally, patients carrying a specific genetic variant (rs1694419 AA) had significantly higher expression levels of SNORD45B compared to those with other genetic variants in various cancer types, including KIRC [PMC7313177]. References: - [PMC7174383]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7174383/ - [PMC10020602]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10020602/ - [PMC5865145]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5865145/ - [PMC9046892]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9046892/ - [PM7313177]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7313177/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUCAAUGAUGUAAUGGCAUGUAUUAGCUGAAUCUAAAGUUGAUGUGAGUUCUAGAAUUACACUGAGACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications