Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-466 URS00002F5FEE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-466: Hsa-mir-466 is a microRNA (miRNA) that has been studied in various contexts. It has been shown to be upregulated in the left atrial appendages (LAAs) of patients with atrial fibrillation (AF) compared to those with normal sinus rhythm (NSR) [PMC3909014]. Additionally, hsa-mir-466 has been found to be downregulated in diabetic conditions and is associated with delayed wound healing in diabetes [PMC8527307]. In a study on human dermal lymphatic endothelial primary cells, hsa-mir-466 was found to inhibit Prospero homeobox 1 (PROX1) expression and suppress lymphangiogenesis [PMC5824028]. Hsa-mir-466 has also been identified as a potential target for the 3ʹUTR of the viral genome in coronaviruses [PMC8527307]. Furthermore, hsa-mir-466 has been shown to regulate the expression of TRH and is repressed by sorafenib treatment in hepatocellular carcinoma patients [PMC7578401]. However, the specific functions of hsa-mir-466 in human cells have not yet been fully elucidated [PMC4304626]. It is worth noting that TaqMan probes for hsa-mir-466 were purchased from Applied Biosystems for various studies mentioned above [PMC5386393][PMC3909014][PMC8584800][PMC4304626].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACACAUACACGCAACACACAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications