Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1286 URS00002EF20A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1286: Hsa-mir-1286 is a microRNA that has been studied in relation to cervical cancer. Yao et al. (69) found that in primary cervical tumors, the expression levels of hsa-mir-1286 were inversely correlated with the methylation status found in cervical cancer cell lines treated with 5-Aza [PMC4055305]. Additionally, hsa-mir-1286 was one of the four intersection miRNAs predicted to be downstream of hsa_circ_0006091, along with hsa-miR-1197, hsa-miR-1248, and hsa-miR-1231 [PMC8973770]. In a network analysis, hsa-mir-1286 was identified as one of the top 10 high-degree miRNAs among 238 miRNAs [PMC9451601]. References: Yao et al. (69) - [PMC4055305] CircInteractome and circBank - [PMC8973770] Network analysis - [PMC9451601]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAGGACCAAGAUGAGCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-1286 (MIR1286)
  2. Gorilla gorilla ggo-miR-1286
  3. Pan troglodytes (chimpanzee) ptr-miR-1286
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-1286
Publications