Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-744-5p URS00002ED61F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-744: Hsa-mir-744 is a mature microRNA that has been shown to be highly expressed in cell lines Rn5-1 and Rn5-20 [PMC7139524]. Increased expression of hsa-mir-744 has also been associated with chemo-resistance in breast cancer patients [PMC9469592]. The differential expression of hsa-mir-744 is not simply a recapitulation of mRNA classification, as it is intronic in the MAP2K4 gene, which plays a role in mRNA subtype classification [PMC3043070]. Functional studies have confirmed that up-regulation of hsa-mir-744 leads to decreased expression of PELI3 [PMC8230573]. Hsa-mir-744 is one of the overexpressed IR-responsive miRNAs that have been found to be deregulated in human cancers [PMC3275573]. TaqMan miRNA primer assays have been used to validate the expression levels of various miRNAs, including hsa-mir-744, in qPCR experiments [PMC9469592]. Hsa-mir-744 has also been found to be associated with TMED2/3/4/9 and other related miRNAs in an interaction network visualized by Cytoscape [PMC9816852]. In a comprehensive study, an 8-miRNA signature with high statistical significance was identified for colorectal cancer patients, which included hsa-mir-744 as one of the prognostic markers [PMC8299930]. Overall, hsa-mir-744 has shown differential expression patterns and functional implications in various cancers, making it a potential target for further research and clinical applications.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCGGGGCUAGGGCUAACAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus (cattle) bta-miR-744
  2. Canis lupus familiaris Cfa-Mir-744_5p (mature (guide))
  3. Cavia porcellus (domestic guinea pig) cpo-miR-744-5p
  4. Dasypus novemcinctus dno-miR-744-5p
  5. Echinops telfairi Ete-Mir-744_5p (mature (guide))
  6. Macaca fascicularis microRNA miR-744-5p
  7. Macaca mulatta (Rhesus monkey) Mml-Mir-744_5p (mature (guide))
  8. Mus musculus mmu-miR-744-5p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-744-5p
  10. Pan troglodytes (chimpanzee) ptr-miR-744
  11. Pongo pygmaeus ppy-miR-744
  12. Rattus norvegicus (Norway rat) Rno-Mir-744_5p (mature (guide))
  13. Sus scrofa (pig) ssc-miR-744
Publications