Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1468-5p URS00002ECEE4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1468: Hsa-mir-1468 is a differentially expressed microRNA (miRNA) that has been identified in various studies. It is upregulated in conditions such as acute myocardial infarction (AMI) [PMC8923688], cattle genome [PMC2713767], and lung adenocarcinoma [PMC6208346]. It is also associated with poor overall survival in pancreatic adenocarcinoma [PMC9158148]. Hsa-mir-1468 has a high purine content, along with other miRNAs such as hsa-mir-765 and hsa-mir-1910 [PMC9316571]. In addition, it has been found to be negatively correlated with the expression of target genes and poor overall survival in various cancers, including hepatocellular carcinoma and epithelial ovarian cancer [PMC6208346]. Hsa-mir-1468 is also implicated in the regulation of mRNA expression of PIP4K2A, which is associated with paclitaxel resistance and worse overall survival in small cell lung cancer patients [PMC7798616][PMC3573965]. Furthermore, it has been used as a biomarker to distinguish steroid-resistant acute severe ulcerative colitis patients with high accuracy [PMC8298863]. Overall, hsa-mir-1468 plays a role in various biological processes and has potential clinical implications.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCCGUUUGCCUGUUUCGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications