Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 1A (SNORD1A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 1A (SNORD1A) URS00002EC433_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD1A: SNORD1A is a C/D box snoRNA that has been implicated in various aspects of leukemia and lymphoma. Dysregulated snoRNAs, including SNORD1A, have been associated with shorter progression-free survival in chronic lymphocytic leukemia (CLL) patients [PMC8975097]. SNORD1A has also been found to play a crucial role in the progression of diffuse large B-cell lymphoma (DLBCL) by influencing ribosomal and mitochondrial processes [PMC9939161]. The expression levels of SNORD1A have been evaluated in samples using quantitative real-time PCR, showing a good correspondence with other techniques [PMC3766210]. Risk models for different cohorts have been established, including SNORD1A as one of the factors [PMC9939161]. In addition to its role as a snoRNA, SNORD1A is hosted by the Small Nucleolar RNA Host Gene 16 (SNHG16) on the 17q.25.1 region [PMC9598326]. The mutations of genes co-expressed with SNORD1A have also been analyzed using the R package "maftools" [PMC9939161]. Overall, these findings highlight the importance of SNORD1A in leukemia and lymphoma and suggest its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACAAGCCUAUGAUGGUUAGUUAUCCCUGUCUGAAAAUCUGGACUGAGGGAAAUAAUCUAUUCUGAGGCUUAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications