v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-451a URS00002E857A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

Hsa-Mir-451: Replicates QG1 and QB1 run with miRNA primer hsa-mir-451 were selected as inter-plate calibrators (IPC), and performed in duplicate upon each 384-well plate [PMC7893782]. In active tuberculosis (TB) patients, the expression of hsa-mir-451 was found to be induced, along with hsa-miR-365, hsa-miR-223, hsa-miR-302a, hsa-miR-486-5p, hsa-miR-144, hsa-miR-21*, and hsa-miR-424 [PMC3189221]. These miRNAs were found to be differentially expressed between active and non-active TB groups [PMC3189221]. Additionally, it has been reported that hsa-mir-451 is up-regulated in glioblastoma compared to normal tissues [PMC4673232].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAACCGUUACCAUUACUGAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis Ami-Mir-451_5p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-451-5p
  3. Bos taurus (cattle) Bta-Mir-451_5p (mature (guide))
  4. Canis lupus familiaris (dog) cfa-miR-451
  5. Cavia porcellus (domestic guinea pig) Cpo-Mir-451_5p (mature (guide))
  6. Cricetulus griseus cgr-miR-451a
  7. Danio rerio (zebrafish) dre-miR-451
  8. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-451_5p (mature (guide))
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-451_5p (mature (guide))
  10. Gadus morhua (Atlantic cod) Gmo-Mir-451_5p (mature (guide))
  11. Gallus gallus (chicken) Gga-Mir-451_5p (mature (guide))
  12. Macaca mulatta (Rhesus monkey) mml-miR-451
  13. Mus musculus (house mouse) mmu-miR-451a
  14. Ornithorhynchus anatinus (platypus) Oan-Mir-451_5p (mature (guide))
  15. Oryctolagus cuniculus (rabbit) Ocu-Mir-451_5p (mature (guide))
  16. Pan troglodytes ptr-miR-451
  17. Pongo pygmaeus (Bornean orangutan) ppy-miR-451
  18. Rattus norvegicus (Norway rat) rno-miR-451-5p
  19. Sus scrofa (pig) ssc-miR-451
  20. Taeniopygia guttata Tgu-Mir-451_5p (mature (guide))
  21. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-451_5p (mature (guide))
  22. Tor tambroides (Thai mahseer) miR-451
  23. Tursiops truncatus (common bottlenose dolphin) miR-451a
  24. Xenopus laevis (African clawed frog) Xla-Mir-451-P2_5p (mature (guide))
  25. Xenopus tropicalis xtr-miR-451
 Publications