Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-451a URS00002E857A_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

Mmu-Mir-451: Mmu-mir-451 is a microRNA that has been found to be associated with various biological processes and diseases. It has been shown to target the 3'-UTR of p300 mRNA, leading to its destabilization [PMC4114167]. Mmu-mir-451 is also known to destabilize cytokine mRNAs [PMC4114167]. However, it is important to note that the expression of mmu-mir-451 may vary between species, and it may not have been detected in certain analyses due to species diversity or stringent filter settings [PMC3627585]. Mmu-mir-451 has been found to be fully expressed in certain samples and used for data normalization in studies [PMC3929876]. It has also been evaluated for expression in the spinal cord using qRT-PCR [PMC3735597]. Mmu-mir-451 has been shown to be involved in the regulation of lung non-specific genes and T-cell acute lymphoblastic leukemia cells [PMC3866260] [PMC3135352]. Additionally, it has been found to be differentially expressed in obesity and its expression can be reversed by certain treatments [PMC4571067] [PMC5559175]. Mmu-mir-451 has also been investigated along with other miRNAs in various studies using different techniques such as luciferase reporter assays and RT-qPCR [PMC3135352] [PMC4448281] [PMC3874166] Finally, mmu-mir-451 levels have been shown to be higher in infected red blood cells compared to non-infected red blood cells during malaria infection.

mmu-mir-451a: Mmu-mir-451a, a down-regulated miRNA, was identified in M1-Exos compared to M2-Exos macrophage samples through microarray data analysis [PMC8766741]. Mmu-miR-32-5p, an upregulated miRNA, was found to be associated with mmu-mir-451a in regulating their common target, Nsmal [PMC5840996]. Additionally, mmu-miR-32-5p and mmu-miR-201-5p were associated with the regulation of NM_008211.3 [PMC5840996]. To validate the miRNA-seq data, qRT-PCR was performed on five randomly selected differentially expressed miRNAs, including mmu-mir-451a [PMC9388336]. Furthermore, mmu-mir-451a was ranked second among the identified miRNAs in a ranking analysis conducted by miREM [PMC6086043].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACCGUUACCAUUACUGAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

Publications