Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4730 URS00002E4C79_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4730: Hsa-mir-4730 is a microRNA that has been studied in relation to its regulatory effects on genes [PMC9867723]. Analyses have shown that hsa-mir-4730, along with hsa-miR-155-5p and hsa-miR-762, affects a significant number of genes [PMC9867723]. In Parkinson's disease (PD) samples, the expression of hsa-mir-4730 is significantly decreased at various time points [PMC9867723]. The fold changes in expression between PD and healthy control samples range from -0.46 to -0.83 for hsa-mir-4730 [PMC9867723]. In a prediction study, 11 out of 12 CIR-miRNAs were found to be associated with enriched GO pathways, except for hsa-mir-4730 [PMC9318750]. Conversely, the expression of microRNAs such as hsa-miR30a5p and hasmiR4284 decreases in response to Jurkat cells derived exosomes [PMC9525320]. The TaqMan MicroRNA Assay was used to amplify the cDNA of mature microRNAs including hasmiR4730 [PMC4583533]. Additionally, TaqMan MicroRNA Assays were used for the primer sets in gene expression assays involving high mobility group A1 (HMGA1) and βactin genes [PMC9106373].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGCGGAGCCCAUUCCAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications