Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-95-3p URS00002E2DE7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-95: Hsa-mir-95 is one of the six miRNAs that showed significant differential expression in both periapical and pulp tissues [PMC9987318]. Among these miRNAs, hsa-mir-95, hsa-miR-375, and hsa-miR-503 were strongly associated with type 2 diabetes mellitus (T2DM) [PMC10126023]. In a study comparing kidney tissues of healthy individuals with those of patients with diabetic nephropathy (DN), hsa-mir-95 was found to be differentially expressed [PMC8616647]. Additionally, hsa-mir-95 was also differentially expressed in a study comparing pancreatic neuroendocrine tumors (PNETs) with pancreatic ductal adenocarcinomas (PDACs) [PMC7352720]. It is suggested that extracellular vesicles containing miRNAs associated with proliferation or apoptosis inhibition, such as hsa-mir-95 or has-miR-106a-5p, may have regenerative potential [PMC10126023]. On the other hand, during control myogenesis, 12 miRNAs were found to be differentially expressed, including hsa-mir-95 as one of the up-regulated ones [PMC4186784]. Overall, these findings highlight the potential role of hsa-mir-95 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAACGGGUAUUUAUUGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus (cattle) bta-miR-95
  2. Canis lupus familiaris (dog) cfa-miR-95
  3. Cervus elaphus (red deer) cel-miR-95
  4. Gorilla gorilla gorilla ggo-miR-95 (MIR95)
  5. Gorilla gorilla (western gorilla) ggo-miR-95
  6. Lagothrix lagotricha (brown woolly monkey) lla-miR-95
  7. Macaca mulatta (Rhesus monkey) mml-miR-95-3p
  8. Pan paniscus ppa-miR-95
  9. Pan troglodytes ptr-miR-95
  10. Pongo pygmaeus (Bornean orangutan) ppy-miR-95
  11. Saguinus labiatus sla-miR-95
  12. Sus scrofa (pig) ssc-miR-95
  13. Tupaia chinensis tch-miR-95
Publications