Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 48 (SNORD48) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 48 (SNORD48) URS00002E0EE8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD48: SNORD48 is a small nucleolar RNA (snoRNA) that is used as a normalizer for relative expression in tissue samples [PMC9021364]. It is also used for normalization in serum and urine samples, along with Cel-miR-39a primer as an internal control [PMC9021364]. SNORD48 has an Assay ID of 203903 [PMC3441572]. In the 160,000× g fraction of non-small cell lung cancer (NSCLC) samples, SNORD48 was found to be downregulated, along with SNORD50D, SNORD18A, SNORD59B, SNORD81 and SNORD29. On the other hand, SNORD113 was upregulated in the supernatant of NSCLC samples [PMC7461500]. These findings suggest that the expression levels of these snoRNAs may be altered in NSCLC and could potentially serve as biomarkers for this type of cancer. However, further research is needed to fully understand the role of these snoRNAs in NSCLC and their potential diagnostic or therapeutic implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUGAUGAUGACCCCAGGUAACUCUGAGUGUGUCGCUGAUGCCAUCACCGCAGCGCUCUGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications