Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-125b-1-3p URS00002DABEA_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGGGUUAGGCUCUUGGGAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Alligator mississippiensis ami-miR-125b-3p
  2. Cavia porcellus cpo-miR-125b-3p
  3. Columba livia cli-miR-125-3p
  4. Dasypus novemcinctus dno-miR-125b-3p
  5. Eptesicus fuscus efu-miR-125a
  6. Homo sapiens hsa-miR-125b-1-3p
  7. Macaca mulatta (Rhesus monkey) mml-miR-125b-1-3p
  8. Ophiophagus hannah (king cobra) oha-miR-125b-3p
  9. Oryctolagus cuniculus ocu-miR-125b-3p
  10. Rattus norvegicus rno-miR-125b-1-3p
  11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4081710
Publications