Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Val (GUN) (MT-TV) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Val (GUN) (MT-TV) URS00002D2D8F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TV: MT-TV is a mitochondrial gene that encodes for tRNA valine [PMC5559820]. In a study, PBMCs collected after immunization with MT-TV or placebo were re-stimulated with overlapping peptides of DENV-1 and DENV-2 proteins [PMC5751980]. The study found that the T cell response in CM, assessed by IFN-γ ELISPOT, showed epitope preference and magnitude [PMC5751980]. The MT-TV mutation was suppressed using the non-cognate leucyl tRNA synthetase [PMC3927954]. Mutations in the 16SrRNA gene (MT-RNR2) have been associated with hypertrophic cardiomyopathy and myopathy [PMC7657662]. SLICE analysis suggested that chondrocytes expressing ASPN + MKI67– (Chond_5) have higher differentiation potential compared to chondrocytes expressing MT-TV + LGALS1– (Chond_3) [PMC9272381]. In tumor epithelial cells, MT-TV expression was found to be low or non-existent in patients without MT-TV mutations [PMC9380328]. Overexpression of mitochondrial aaRS (AARS2 or FARS2 tRNA synthetase) was explored to suppress the MT-TV mutation [PMC3927954]. PCR amplification and ultra-deep sequencing were used to assess mtDNA SNVs in a 4,767 bp mtDNA fragment spanning various genes including MT-RNR1, MT-RNR2, and MT-TV [PMC5121427]. Normal epithelial cells from adjacent tissues showed low expression of wild-type alleles of the MT-TV gene [PMC9380328]. Differential expression analysis identified several genes including protein-coding genes (MT-ND1, MT-ND2, etc.), rRNAs, and tRNAs (including MT-TV) as differentially expressed [PMC7934845].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGAGUGUAGCUUAACACAAAGCACCCAACUUACACUUAGGAGAUUUCAACUUAACUUGACCGCUCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cloning vector pRS316-1B9 tRNA-Val
  2. Homo heidelbergensis (Heidelberg man) tRNA-Val
  3. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Val
  4. Homo sapiens subsp. 'Denisova' transfer RNA-Val
2D structure Publications