Sequence URS00002D0E0C 4 species

This unique sequence was observed in multiple species. Filter annotations by species.

Overview

  • tRNA from 4 species
  • 67 nucleotides
  • 1 database (ENA)
  • Found in 4 species
  • imported
  • last updated

Annotations 279 total

Loading database cross-references...

Genome browser

Sequence

67 nucleotides Search for similar sequences

GUCUUGAUAGUAUAAACAUUACUCUGGUCUUGUAAACCUGAAAUGAAGAUCUUCUCUUCUCAAGACA

Taxonomic Tree

This sequence has been observed in 4 species. Get species-specific urls by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Loading taxonomic tree...

Publications

Loading publications...

Results Searching... 1 sequence {{result.entries.length}} out of {{result.hitCount | number}} sequences

Search help
There was an error while processing your query

Suggestions

  • Try reloading the page

  • Contact us if the problem persists

There was an error while exporting search results.
Please try again or contact us if the problem persists.
No results

Suggestions

  • Make sure your spelling is correct

    Example: misspelled terms like Esherichia (missing "c") won't find any results

  • Use full species names

    Example: use Escherichia coli and not E. coli as your search terms

  • Make sure to include double quotes in field-specific search using the field:"field value" format

  • Read more about query syntax

  • {{rna.id}}

    • {{rna.fields.length[0] | number}} nucleotides
    • Obsolete

Displaying {{result.entries.length}} out of {{result.hitCount | number}} sequences