Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-222-3p URS00002C6949_9606

mRNA interactions 27 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUCUGGCUACUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Bos taurus (cattle) bta-miR-222
  2. Canis lupus familiaris (dog) cfa-miR-222
  3. Equus caballus (horse) eca-miR-222
  4. Macaca mulatta mml-miR-222-3p
  5. Mus musculus (house mouse) TARBASE:mmu-miR-222-3p
  6. Ornithorhynchus anatinus oan-miR-222a-3p
  7. Pongo pygmaeus ppy-miR-222
  8. Rattus norvegicus (Norway rat) rno-miR-222-3p
  9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
  10. Tupaia chinensis tch-miR-222-3p
  11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3161177
Publications