Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3180-3p URS00002C4233_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-3180: Hsa-mir-3180 is a microRNA that has been identified as one of the top five upregulated microRNAs [PMC8034913]. It has been found to be a predictor of 90-day mortality in patients [PMC8890551]. The expression of hsa-mir-3180 has been quantified using TaqMan™ MicroRNA Assays [PMC9519568]. In various studies, hsa-mir-3180 has been shown to be upregulated in tumor samples and associated with poor survival outcomes and higher TNM stage in hepatocellular carcinoma (HCC) patients [PMC10083302]. It has also been found to be overexpressed in HCC and associated with the Hepatitis B, Hepatitis C, and hepatocellular carcinoma pathways, indicating its role in liver carcinogenesis [PMC10083302]. Hsa-mir-3180 has shown a stronger association with HCC patient clinicopathological characteristics compared to hsa-miR-378i, making it a potential biomarker for HCC diagnosis [PMC10083302]. The expression of hsa-mir-3180 is significantly higher in tumor samples compared to healthy samples [PMC10083302]. It is also associated with poor survival outcomes and high TNM stage in gastric carcinoma cell lines [PMC10083302]. The potential target genes of hsa-mir-3180 include CD81 and CDKN1A, which are involved in liver diseases pathways [PMC10083302][PMC9374467][PMC7997684][PMC9526595].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGGCGGAGCUUCCGGAGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications