Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 96A (SNORD96A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 96A (SNORD96A) URS00002C37BE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD96A: SNORD96A is a differentially expressed (DE) small nucleolar RNA (snoRNA) that has been identified in both synovial fluid and plasma samples [PMC9393553]. In an ageing/OA human cartilage study, SNORD96A was found to be one of the DE snoRNAs identified in the plasma, along with other snoRNAs such as snord15, snord2, snord21, snord46, snord58, and U3 [PMC9393553]. Furthermore, a study used a qPCR assay and identified SNORD96A as one of the genes used as an endogenous reference gene (eRG) along with SNORD95 and RNU6-2 [PMC7555752]. This study compared patients to control subjects and found that two microRNAs (miR-124-3p and miR-2861) were up-regulated in patients while three microRNAs (miR-21-5p, miR-23a, and miR-29a-3p) were down-regulated [PMC7555752]. These findings suggest that SNORD96A may play a role in the regulation of microRNA expression in patients compared to control subjects. However, further research is needed to fully understand the functional significance of SNORD96A in these contexts.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGGUGAUGACAGAUGGCAUUGUCAGCCAAUCCCCAAGUGGGAGUGAGGACAUGUCCUGCAAUUCUGAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications