Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) mitochondrially encoded tRNA-Ser (AGU/C) 2 (MT-TS2) URS00002C130C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TS2: MT-TS2 is a gene that encodes for a transfer RNA (tRNA) molecule in the mitochondrial genome. The m.12207G > A variant in the MT-TS2 gene has been associated with complex I deficiency and various clinical manifestations, including developmental delay, feeding difficulty, proximal muscle weakness, lesions within the basal ganglia, cerebral atrophy, increased blood lactate, liver dysfunction, and fatty infiltration in muscle [PMC10034148]. Northern blot analysis has shown that the levels of several transcripts encoded on the L strand of mitochondrial DNA are less decreased in the absence of POLRMT compared to transcripts encoded on the H strand [PMC4975551]. In a patient with complex I deficiency and developmental delay, a homoplasmic mitochondrial variant of uncertain significance (VOUS) was detected in MT-TS2 (m.12236G>A) [PMC8743230]. Additionally, there was a heterozygous missense mutation in the NLRP3 gene [PMC8743230]. The distribution of mutations across various mitochondrial tRNA genes is extensive [PMC7755120]. In a study comparing gene signaling interactions between offspring from high-fat diet-fed and control mice, MT-TS2 was identified as one of several genes upregulated in high-fat diet offspring [PMC5494892].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGAAAGCUCACAAGAACUGCUAACUCAUGCCCCCAUGUCUAACAACAUGGCUUUCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Cloning vector pRS316-1B9 tRNA-Ser
  2. Homo heidelbergensis (Heidelberg man) tRNA-Ser
  3. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Ser
  4. Homo sapiens subsp. 'Denisova' tRNA-Ser
Publications