Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans cel-miR-241-5p URS00002BFC83_6239

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cel-let-7: Cel-let-7 is a microRNA that has been studied in various organisms, including C. elegans and H. contortus [PMC1933138]. It is involved in regulating developmental transitions and has been found to interact with circRNAs in H. contortus larval development [PMC8645938]. Cel-let-7 has also been shown to silence lin-41 mRNA through binding to its 3' untranslated region [PMC1698263]. It has a homologous relationship with hco-miR-5991 and can interact with 167 circRNAs [PMC8645938]. Cel-let-7 is part of the let-7 cluster, which also includes mir-51, mir-53, mir-54, mir-55, and mir56 [PMC3384580]. In C. elegans and Drosophila melanogaster, cel-lin4 and cel-let7 are the only members of the let7 cluster [PMC6531867]. The identification of miRNAs like cel-lin4 and cel-let7 has been done through a combination of genetic methods and RNA sequencing [PMC3535529]. The distribution histogram of free energy for cel-let7 with its control sequences can be seen in Figure 2B [PMC1933138]. The prediction for cel-let7 can be seen in Figure 8a, which was subsequently verified in miRBase release 14 [PMC3110143]. In summary, cel-let-7 is a microRNA that plays important roles in developmental transitions and gene regulation across different organisms [PMC1933138][PMC8645938].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGGUGCGAGAAAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications