Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4435 URS00002BBA1C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-4435: Hsa-mir-4435 is a miRNA that has been found to be dysregulated in various diseases, including breast cancer, lung adenocarcinoma, hepatocellular carcinoma, multiple sclerosis, diabetic retinopathy, and pregnancy complications [PMC8158160] [PMC7138293] [PMC8641180] [PMC9820840] [PMC8000127] [PMC8545528] [PMC8539647]. In breast cancer patients, dysregulation of hsa-mir-4435 has been associated with poor overall survival (OS) and higher metastatic potential [PMC8158160]. It has also been identified as a potential metastatic biomarker in breast cancer due to its higher expression in highly metastatic cell lines compared to low metastatic cell lines [PMC8158160]. In lung adenocarcinoma (LUAD), hsa-mir-4435 is part of a miRNA signature that can classify pathological stages of the disease and has similar classification ability as other combinations of miRNAs [PMC7138293]. In hepatocellular carcinoma (HCC), hsa-mir-4435 is co-expressed with other miRNAs involved in HCC development and progression [PMC9820840]. In multiple sclerosis (MS), hsa-mir-4435 is expressed specifically in B cells but not in lymphoblastoid cell lines (LCLs) and may play a role in the disease pathogenesis [PMC8000127]. Additionally, hsa-mir-4435 has been associated with diabetic retinopathy progression and its host gene MIR4435-2HG may regulate diabetic retinopathy-related genes through this miRNA's activity [PMC8545528]. Finally, during pregnancy, hsa-mir-4435 expression is deregulated and it may be involved in common gestational complications due to its association with other miRNAs implicated in pregnancy [PMC8539647].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGGCCAGAGCUCACACAGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications