v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-92a precursor (hsa-mir-92a-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-92a precursor (hsa-mir-92a-1) URS00002B6637_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR92A1: Investigating the locus revealed that the miR17-92 cluster, which includes MIR17, MIR18A, MIR19A, MIR20A, MIR19B1, and MIR92A1, is affected by copy gains or amplifications [PMC9259584]. In Alzheimer's disease (AD), MIR199A2, MIR218-2, MIR24-2, MIR92A1, and MIR99A were found to be upregulated, while MIR129-2, MIR1296, MIR219A1, MIR29B1, MIR375, MIR411, and MIR431 were downregulated [PMC7564652]. The targets of MIR199A2, MIR219A1, MIR24-2, MIR375, MIR411, and MIR92A1 are known, but their role in AD is not clear [PMC7564652]. Dysregulation of several miRNAs, including MIR29B1, MIR129-2, MIR219A1, MIR199A2, MIR92A1, and MIR1296, has been observed in AD patients [PMC7564653][PMC632161][PMC400563][PMC959924]. The miR17-92 cluster has been found to be upregulated in both medaka and human melanoma models [PMC6321611]. A microduplication at 13q31.3 was detected, which encompassed the miR-17 ~ 92 cluster genes and the first five exons of the GPC5 gene [PMC4005632]. A p53 binding site in the human MIR92A1 locus was also identified [PMC9207587].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Ailuropoda melanoleuca mir-92 microRNA precursor family
  2. Aotus nancymaae miRNA (ENSANAG00000004922.1)
  3. Ateles geoffroyi microRNA age-mir-92 precursor (age-mir-92-1)
  4. Bos taurus microRNA bta-mir-92a precursor (bta-mir-92a-1)
  5. Callithrix jacchus mir-92 microRNA precursor family
  6. Camelus ferus mir-92 microRNA precursor family
  7. Canis lupus familiaris mir-92 microRNA precursor family
  8. Carlito syrichta miRNA (ENSTSYG00000021444.2)
  9. Cavia porcellus microRNA 92a-1 (ENSCPOG00000016799.3)
  10. Cebus imitator (Panamanian white-faced capuchin) microRNA 92a-1 (ENSCCAG00000016785.1)
  11. Cercocebus atys miRNA (ENSCATG00000011899.1)
  12. Chinchilla lanigera microRNA 92a-1 (ENSCLAG00000021281.1)
  13. Chlorocebus sabaeus mir-92 microRNA precursor family
  14. Colobus angolensis palliatus miRNA (ENSCANG00000001649.1)
  15. Equus caballus mir-92 microRNA precursor family
  16. Felis catus (domestic cat) mir-92 microRNA precursor family
  17. Gorilla gorilla gorilla ggo-mir-92-1 (ENSGGOG00000033055.2)
  18. Gorilla gorilla (western gorilla) microRNA ggo-mir-92 precursor (ggo-mir-92-1)
  19. Heterocephalus glaber mir-92 microRNA precursor family
  20. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 92a-1 (ENSSTOG00000016693.3)
  21. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-92 precursor (lla-mir-92-1)
  22. Lemur catta (Ring-tailed lemur) microRNA lca-mir-92 precursor (lca-mir-92-1)
  23. Macaca mulatta (Rhesus monkey) microRNA mml-mir-92a precursor (mml-mir-92a-1)
  24. Macaca nemestrina miRNA (ENSMNEG00000005615.1)
  25. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000018759.1)
  26. Marmota monax non-coding RNA
  27. Microcebus murinus microRNA 92a-1 (ENSMICG00000018733.3)
  28. Otolemur garnettii mir-92 microRNA precursor family
  29. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-92a precursor (ppa-mir-92a-1)
  30. Panthera pardus (leopard) microRNA 92a-1 (ENSPPRG00000013776.1)
  31. Panthera tigris altaica (Tiger) microRNA 92a-1 (ENSPTIG00000002967.1)
  32. Pan troglodytes microRNA ptr-mir-92 precursor (ptr-mir-92-1)
  33. Papio anubis (Olive baboon) mir-92 microRNA precursor family
  34. Pongo pygmaeus mir-92 microRNA precursor family
  35. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000008762.1)
  36. Pteropus alecto (black flying fox) mir-92 microRNA precursor family
  37. Pteropus vampyrus (large flying fox) microRNA 92a-1 (ENSPVAG00000025207.1)
  38. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000013317.1)
  39. Rhinopithecus roxellana microRNA 92a-1 (ENSRROG00000007886.1)
  40. Saguinus labiatus microRNA sla-mir-92 precursor (sla-mir-92-1)
  41. Saimiri boliviensis boliviensis microRNA 92a-1 (ENSSBOG00000018855.1)
  42. Sus scrofa (pig) mir-92 microRNA precursor family
  43. Tursiops truncatus (bottlenosed dolphin) microRNA 92a-1 (ENSTTRG00000021803.1)
  44. Vicugna pacos microRNA 92a-1 (ENSVPAG00000015675.1)
 2D structure Publications