v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PHC2 antisense RNA 1 (PHC2-AS1) URS00002ADFF9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PHC2-AS1: PHC2-AS1 is a long non-coding RNA (lncRNA) that has been studied in relation to necroptosis and immune checkpoints [PMC8883231]. It has been found to be correlated with the expression levels of immune checkpoints CTLA-4, PD-1, and PD-L1 [PMC8883231]. Additionally, PHC2-AS1 is one of the 56 differentially expressed lncRNAs that are associated with prognosis in various cancers [PMC8883231]. In a risk model analysis, PHC2-AS1 was identified as one of the four lncRNAs with prognostic value [PMC10047351]. The risk score formula for this model includes PHC2-AS1 as a variable [PMC10047351]. Furthermore, PHC2-AS1 was found to have significant prognostic value in colorectal cancer (COAD) [PMC10047351]. In COAD, PHC2-AS1 was one of the 12 lncRNAs identified as having prognosis value [PMC9539748].

Targeting miRNAs 4 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCACACCUCCGUGAGCGGCCUCGGGCUCGCGGUUGAGGCUGAUUGAGGAAGUGGGUUCAGGCGGCCCGCCGUGCCUGGCACACGGUCAGAGUCCCCUGACAGGACUUUCCCCUUUCUCUGAGAUGACAAUCAGGCCGCUUUGCUUUGCACUGCCCUCAGAGAAGCAGUGUGCCCAGAAGUCAAGUGUGAGCUCUUGAGUCAAAAUGCUUGGAUUUGAAUUCCAACUCUGCUGCUUACCAGCUGUGUGACAUGGGGUGAGUGAGUUACCUGACCUCUCUGUACCUCUAUGUCAUCAUCUUUAAAAUGGAGCCCACAGCAACCAGGGAAAUAGUCUAACAGAAGCCUAGGAUGAAGAAUUUCGGGAAAGAAGAAACGUCCAGCAAGGCCAAGUCCCUUUGUGUGUCAGUCUGCUUUCUCUCUCACACAUACGUGCACACAGGCUCGUACACACAAAGAUGUUAAGCAAAAUAUAAAGCCCCUCCACUGAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications