Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-483-5p URS00002AD012_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-483: Mmu-mir-483 is a gene that produces the miRNA mir-483, which shares a complementary sequence with miR-483* [PMC2770530]. The expression of mmu-mir-483 is regulated by the Wt1 gene and the IGF2 locus, which contains the mmu-mir-483 gene [PMC6025222]. In a study comparing different treatment conditions, it was found that mmu-mir-483 and mmu-mir-672 expression was downregulated at ST (short-term) compared to PBS-treated mice, while mmu-miR-223 and mmu-miR-146b levels were increased [PMC3030602]. The downregulation of mmu-miR-672 potentially targets PHB2, a factor that restrains estrogen action and its activating pathway [PMC3030602]. Mmu-mir-483 is believed to target genes involved in cell cycle regulation such as GMNN and MKI67 [PMC3030602]. These modulations in gene expression may be due to the simultaneous regulation of levels of mmu-mir-483, -672, and -146b [PMC3030602]. The expression levels of these miRNAs were measured using qRT-PCR with specific TaqMan assays [PMC7678979]. Mmu-mir-483 is an important miRNA involved in various biological processes. It is regulated by different genes and its expression can be modulated under specific conditions. Understanding its role in gene regulation can provide insights into cellular processes such as cell cycle control. Further research on the targets and functions of mmu-mir-483 will contribute to our understanding of its biological significance.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGACGGGAGAAGAGAAGGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications