v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-125b precursor (hsa-mir-125b-1) URS00002A66E1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR125B1: MIR125B1 is a miRNA gene that has been reported as dysregulated in Alzheimer's disease (AD) brains [PMC4861808]. Ten CpG sites, including cg03891346, overlap with miRNA genes that have been previously reported as dysregulated in AD brains, such as MIR34B/C, MIR9-1, MIR34A, MIR146B, MIR124-1, MIR181C/D, MIR451, and MIR9-3 [PMC4861808]. Specifically, cg03891346 annotated to MIR125B1 has been associated with the expression level of miR-100-5p [PMC7056871]. These findings suggest a potential role of dysregulated miRNA genes in the pathogenesis of AD [PMC4861808]. Further research is needed to understand the specific mechanisms by which these dysregulated miRNAs contribute to the development and progression of AD [PMC4861808].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Aotus nancymaae miRNA (ENSANAG00000004735.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-125b precursor (age-mir-125b-1)
  3. Cercocebus atys miRNA (ENSCATG00000014567.1)
  4. Chlorocebus sabaeus microRNA 125b-1 (ENSCSAG00000027610.1)
  5. Colobus angolensis palliatus miRNA (ENSCANG00000012717.1)
  6. Gorilla gorilla gorilla ggo-mir-125b-1 (ENSGGOG00000032538.2)
  7. Gorilla gorilla (western gorilla) microRNA ggo-mir-125b precursor (ggo-mir-125b-1)
  8. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-125b precursor (lla-mir-125b-1)
  9. Macaca mulatta microRNA mml-mir-125b precursor (mml-mir-125b-1)
  10. Macaca nemestrina microRNA mne-mir-125b precursor (mne-mir-125b-1)
  11. Mandrillus leucophaeus miRNA (ENSMLEG00000018550.1)
  12. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 125b-1 (ENSNLEG00000021154.2)
  13. Pan paniscus (bonobo) ppa-mir-125b (ENSPPAG00000016535.1)
  14. Pan troglodytes (chimpanzee) microRNA ptr-mir-125b precursor (ptr-mir-125b-1)
  15. Pongo abelii (Sumatran orangutan) miRNA
  16. Pongo pygmaeus microRNA ppy-mir-125b precursor (ppy-mir-125b-1)
  17. Rhinopithecus bieti miRNA (ENSRBIG00000013172.1)
  18. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000007715.1)
  19. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-125b precursor
  20. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000007694.1)
 Publications