Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-520d-5p URS00002A037E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-520d: Hsa-mir-520d is a microRNA (miRNA) that has been studied in various contexts. It has been mentioned in several studies as one of the miRNAs that have not been verified [PMC9483142]. In one study, hsa-mir-520d was found to be upregulated more than 8-fold in CP tissue compared to healthy gingiva [PMC7606899]. It is a member of the miRNA family of hsa-mir-520b, along with hsa-mir-520c and hsa-mir-520a, which were confirmed by dbDEMC [PMC6295065]. Hsa-mir-520d belongs to the "miR-302-3p/372-3p/373" and "miR-520" families [PMC5584237]. Another study reported upregulation of hsa-mir-520d with more than eight-fold difference compared to healthy gingival tissues [PMC6170608]. Hsa-miR-1228 and hsa-mir-520d were identified as the best reference genes for normalizing miRNA analysis in colorectal adenocarcinoma samples [PMC7112021]. Hsa-miR-1228 and hsa-mir-520d have also been identified as suitable reference genes for normalizing miRNAs from plasma, exosome, and tissue obtained from colorectal cancer patients [PMC6367481]. Overall, hsa-mir-520d is a miRNA that has shown differential expression in various conditions and has been identified as a potential reference gene for normalizing miRNA analysis. Further research is needed to fully understand its role and significance in different biological processes. References: [PMC9483142] [PMC7606899] [PMC6295065] [PMC5584237] [PMC6170608] [PMC7112021] [PMC6367481]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUACAAAGGGAAGCCCUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pongo pygmaeus ppy-miR-520i
Publications