Homo sapiens (human) small nucleolar RNA, H/ACA box 24 (SNORA24)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, H/ACA box 24 (SNORA24) URS000029D639_9606

131 nucleotides
9 databases (ENA, Ensembl, GeneCards, HGNC, MalaCards, RefSeq, Rfam, snoDB, snOPY)
Found in 2 other species
64 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA24: SNORA24 is a type of small nucleolar RNA that has been implicated in tumour initiation and the maintenance of RAS-driven cancers in both humans and mice [PMC8943959]. In a study conducted in 2009, the activity of SNORA24 on 18S rRNA at position 609 was confirmed [PMC8522698]. These findings suggest that SNORA24 dysfunction may play a significant role in the development and progression of cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CUCCAUGUAUCUUUGGGACCUGUCAGCCGUGGCAGUCUCCCUUCCUAGCCAUGGAAGAGCAUAUCCUUGUUUAUUGGCAAAGCUGUCACCAUUUAAUUGGUAUCAGAUUCUGACUUGCACAAGUAACAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.