v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7g-3p URS000029979D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-let-7g: Hsa-let-7g is a microRNA that has been studied using Custom TaqMan® MicroRNA Single Assays [PMC5494906]. The binding site of HOXB1 was incorporated into the hsa-let-7g sequences, which were then subcloned into the pGL3 basic vector [PMC7044691].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGUACAGGCCACUGCCUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Alligator mississippiensis (American alligator) ami-let-7g-3p
  2. Chrysemys picta cpi-let-7g-3p
  3. Cricetulus griseus cgr-let-7g-3p
  4. Mus musculus Mus_musculus piRNA piR-mmu-48741675
  5. Python bivittatus pbv-let-7g-3p
  6. Rattus norvegicus rno-let-7g-3p
  7. Taeniopygia guttata tgu-let-7g-3p
 Publications