Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-519d-3p URS0000298BA3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-519d: Hsa-mir-519d is a microRNA that has been found to be associated with various functions and diseases. In a study, it was discovered that the pseudogene RPLP0P2 can bind to hsa-mir-519d, along with other microRNAs such as hsa-miR-424, hsa-miR-373, hsa-miR-372, hsa-miR-205, and hsa-miR-183 [PMC7249743]. Previous research has suggested that hsa-mir-519d may be closely linked to hepatocellular carcinoma (HCC), but its specific functions in HCC are still not well understood [PMC7167370]. C19MC miRNAs, including hsa-mir-519d, are involved in regulating implantation through the inhibition of epithelial-to-mesenchymal transition [PMC9104507]. In a comparison of pancreatic ductal adenocarcinoma (PDAC) tissues and adjacent normal controls, it was found that the expression levels of 23 miRNAs were different between the two groups. Among these miRNAs were both upregulated (hsa-miR-10b, hsa-miR-575, etc.) and downregulated (hsa-miR-1, hsa-miR19a etc.) ones. Hsa-mir-519d was one of the downregulated miRNAs in PDAC tissues [PMC5649611]. Additionally, in abdominal tissue samples it was observed that hsa-mir520c3p/520f and hsa-hmir183 were associated with their target mRNAs and showed differential expression across tissues [PMC3216936]. These findings highlight the potential importance of understanding the functions and roles of HSA-MIR 519D in various diseases and biological processes.

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGCCUCCCUUUAGAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-519d (MIR519D)
  2. Gorilla gorilla ggo-miR-519d
  3. Pan troglodytes ptr-miR-519d
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-519d
Publications