Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 55 (SNORD55) URS000029360B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD55: SNORD55 is a small nucleolar RNA (snoRNA) that has been implicated in various diseases, including hepatocellular carcinoma and non-small cell lung cancer (NSCLC) [PMC9818347]. In hepatocellular carcinoma, four snoRNAs, including SNORD55, were found to be upregulated in the plasma of cancer patients compared to healthy donors [PMC9818347]. However, there is no mention of the downregulation of SNORD116-3 and SNORD116-24 in hepatocellular carcinoma patients [PMC9818347]. In the context of NSCLC, a study enrolled 189 healthy donors and 290 NSCLC patients to investigate the differential expression of SNORD55 in tumor-educated platelets (TEPs) [PMC7919130]. TEPs were collected from these individuals and subjected to quantitative polymerase chain reaction (qPCR) analysis [PMC7919130]. The study aimed to determine if SNORD55 expression levels could serve as a potential biomarker for NSCLC diagnosis or prognosis [PMC7919130]. These findings highlight the potential role of SNORD55 as a biomarker for various diseases and emphasize the importance of further research in understanding its functional significance [PMC9818347][PMC7919130].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUAUGAUGACAACUCGGUAAUGCUGCAUACUCCCGAGUGCGCGGUGGGGAAGCCAACCUUGGAGAGCUGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications