Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-374a-3p URS0000285DCB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-374: Hsa-mir-374 is a microRNA that has been detected in plasma and has been linked to various neurodegenerative disorders, including Amyotrophic lateral sclerosis, Alzheimer's disease, and Parkinson's disease, as well as immune-related diseases such as T‐cell acute lymphoid leukemia and inflammatory processes in diabetes [Gimenes-Teixeira et al., 2013; Qian et al., 2015; PMC9713411]. It has been used as a reference for miRNA expression normalization in different tissues and samples, such as solid tissues [PMC4919505], cultured cells [PMC4919505], and serum samples [PMC4919505]. Hsa-mir-374 expression has been found to co-occur with hsa-miR-218 in various independent experiments [PMC3479204]. It has also been used as a housekeeping control in different studies involving miRNA expression analysis [PMC10126132; PMC3195087]. Hsa-mir-374 has been identified as one of the potential biomarkers for distinguishing between benign and malignant parotid neoplasms based on its differential expression in whole saliva samples [PMC4636154]. Furthermore, hsa-mir-374 is involved in the regulation of MECP2 expression and activity, interferon alpha/beta signaling (hsa-miR-1227), oncogene-induced senescence, glycosaminoglycan metabolism (hsa-miR-148a), and transcriptional regulation of granulopoiesis [PMC7582243]. It is also implicated in the activation of Wnt/b-catenin signaling pathway during the implantation process [PMC5339930].

hsa-mir-374a: Hsa-mir-374a is a miRNA-like sequence identified within the env and the gag-pol encoding regions of several HIV-1 strains [PMC7041288]. Previous studies have shown that hsa-mir-374a can reduce the risk of colorectal cancer [PMC6221654]. In a study, the top three lncRNAs were AC133528, AC109927, and AL021707; the top three mRNAs were TMEM88B, GHRHR, and ZC3HAV1L; the top three miRNAs were hsa-mir-545, has-mir-548k, and hsa-mir-374a; and the top three DNA methylation sites were cg17863551, cg08491964, and cg04067612 [PMC8176021].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUAUCAGAUUGUAUUGUAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Callithrix jacchus cja-miR-374a
  2. Dasypus novemcinctus dno-miR-374a-3p
  3. Macaca mulatta (Rhesus monkey) mml-miR-374a-3p
  4. Nomascus leucogenys nle-miR-374a
Publications