Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-147a URS00002849B7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-147a: Hsa-mir-147a is a microRNA (miRNA) that has been studied in relation to lung neoplasms [PMC6449885]. In a recent study, 12 hub miRNAs, including hsa-mir-147a, and 15 hub miRNA sponges were identified [PMC7591752]. Additionally, several miRNAs targeting specific genes were identified, including hsa-mir-147a targeting CDKN2A [PMC9981365]. However, in the analysis of miRCancer, dbDEMC, and PhenomiR databases, hsa-mir-147a was not confirmed [PMC6449885]. In the regulatory network analysis of CGs (Cancer Genes), several transcription factors (TFs) and miRNAs were identified as regulators of CGs. Hsa-mir-147a was one of the miRNAs identified as a post-transcriptional regulator [PMC10000172]. References: - [PMC7521494]: Primer sequences were as follows: hsa_circ_0072995 (5’- AGAACAGCTATGCCCTCCAG-3’, 3’-CCCATCTCATAGCCAGGTGT-5’), hsa-mir-147a (5’-GCGGGCGTGTGTGAAATGC-3’, 3’-ATCCAGTGCAGGGTCCGAGG-5’), and CDK6 (5’CCGTGGATCTCTGGAGTGTT3’, 3’GGTTGGGCAGATTTTGAATG5’) [PMC7521494] -[PMC6449885]: A recent study showed that hsa-mir-147a is related to lung neoplasms. Among these miRNAs, 48 miRNAs were confirmed in miRCancer, dbDEMC, and PhenomiR databases, and only two miRNAs (hsa-mir-520 g, hsa-mir-147a) were not confirmed. [PMC6449885] -[PMC7591752]: In this work, we have identified 12 hub miRNAs (hsa-miR-195-5p, hsa-miR-15a-5p, hsa-miR-26b-5p, hsa-miR-23a-3p, hsa-miR-93-5p, hsa-miR-2103p, hsa-miR25 3p, hsa miR30b 5p, hsami R148b 3p, hsami R149 5 p, hsami R200c 3 p and hsamir147 a) and 15 hub miRNA sponges (SLC38A2, SHOC2, DDX6, WSB1, PURB, DDX5 DLEU2 USP15 C6orf62 ADAM10 STK4 LBR PNISR ANKRD44 SERINC1). [PMC7591752] -[PMC9981365]: Subsequently, 110 miRNAs targeting IGF2 including hsa let7 a 5 p hsamir125b 5 p hsamir9 3 p 83 miRNAs targeting EGFR including hsamir27 a 3 p hsamir30 a and hsamir7 and so on were identified. Among these miRNAs targeting specific genes were identified including hsamir147 a targeting CDKN2A. [PMC9981365] -[PMC10000172]: The CGs regulatory network analysis detected some essential TFs proteins (NFIC, FOXC1, YY1, and GATA2) and miRNAs (hsa-mir-147a, hsa-mir-129-2-3p, hsa-mir-124-3p, hsa-mir-34a-5p, hsa-mir-23b-3p, and hsa-mir16 5 p) as the transcriptional and post-transcriptional regulators of CGs. [PMC10000172]

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUGUGGAAAUGCUUCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Macaca nemestrina mne-miR-147
  2. Pan paniscus (pygmy chimpanzee) ppa-miR-147
  3. Pan troglodytes ptr-miR-147a
  4. Pongo pygmaeus (Bornean orangutan) ppy-miR-147a
  5. Saguinus labiatus sla-miR-147
Publications