Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans cel-miR-248 URS000027E961_6239

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cel-mir-248: Cel-mir-248 is a spike-in oligo commonly used for normalization in RNA extraction and miRNA expression analysis experiments [PMC8005714] [PMC7204029] [PMC5952410] [PMC9691121] [PMC5349967] [PMC7423998] [PMC4673232] [PMC7281602] [PMC7293253] [PMC8584247] [PMC7465670]. It is often used alongside other spike-in oligos such as cel-miR-254, ath-miR-159a, osa-miR-414, and osa-miR-442 to ensure accurate normalization in various experiments and assays involving miRNA expression analysis and RNA extraction from exosomes or plasma samples [PMC8005714] [PMC7204029] [PMC5952410] [PMC9691121] [PMC5349967] [PMC7423998] [PMC4673232] [PMC7281602] [PMC7293253] [PMC8584247] [PMC7465670]. Cel-mir-248 is typically added to samples at a concentration of 200 pM or 1000 attomoles/spike-in, depending on the specific experiment or assay being conducted [PMC8005714]. It serves as a reference gene to normalize the expression of mature single miRNAs in various samples, including exosomal pellets and plasma samples [PMC5952410]. The normalization process involves adding cel-mir-248 to each sample either before or after lysis, depending on the specific protocol being followed [PMC7204029]. Different methods, such as the TaqMan Stem-loop miRNA assay or Nanostring nCounter Human v3a miRNA Expression Assay, are used to assess the expression of miRNAs, with cel-mir-248 being used as the reference gene for normalization purposes [PMC5952410] [PMC8584247]. Cel-mir-248 is part of a panel of spike-in probes that also includes other non-endogenous miRNAs from different species, such as ath-miR159a, cel-miR254, osa-miR414, and osa-miR442, which are incorporated into code sets used for analysis alongside positive and negative controls to ensure accurate measurement of miRNA expression levels in the samples [PMC7423998] [PMC8584247].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACACGUGCACGGAUAACGCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications