Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1250-5p URS0000277201_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1250: Hsa-mir-1250 is a microRNA that has been studied in relation to overall survival and its role in various diseases [PMC8797878]. It is one of the top six miRNAs selected to construct a regulatory network and has been found to be associated with poor prognosis [PMC8797878]. Hsa-mir-1250 has also been identified as one of the miRNAs that bind to hsa_circ_0065898 [PMC8797878]. It is targeted by hsa-miR-520h, hsa-miR-874, hsa-miR-634, and hsa-miR-520g [PMC8483823]. Hsa-mir-1250 originated after the human-chimp split and seems to play a role in oligodendrocyte proliferation and differentiation [PMC3544654][PMC5123339]. In breast cancer luminal A, hsa-mir-1250 is one of the 11 identified miRNAs that could be key modulators of various pathways [PMC5123339]. Hsa-mir-1250 has also been described in the white matter tracts of the human brain [PMC5123339]. In metastatic cancer, at least 36 metastamiRs, including hsa-mir-1250, have been found to be altered [PMC4491873]. References: [PMC8797878] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8797878/ [PMC8483823] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8483823/ [PMC3544654] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3544654/ [PM5123339] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM5123339/ [PM4491873] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM4491873/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGGUGCUGGAUGUGGCCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications