Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 83B (SNORD83B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 83B (SNORD83B) URS000027315D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD83B: SNORD83B is an orphan C/D box snoRNA that has been found to have various functions in gene regulation. It has been shown to reduce the stability of NOP14, SRSF3, and RPS5 [PMC7093170]. Additionally, SNORD83B has been found to regulate gene expression by binding to target mRNAs, revealing an unexpected function of snoRNAs [PMC7416809]. SNORD83B is one of the snoRNAs that have unexpected interactions with mRNAs and can control the steady-state levels of target mRNAs [PMC6798851]. It can be synthesized and expressed from the intron of the SNHG5 gene [PMC6848142]. SNORD83B has also been shown to have no meaningful KRAS binding activity [PMC6848142]. Furthermore, it stabilizes the levels of target mRNAs such as NOP14, RPS5, and SRSF3 [PMC8508363]. The expression signature of snoRNAs in CHIKV-infected HEK293T cells showed upregulation of SNORD83B among others [PMC9967650]. It has also been found to have interactions with multiple mRNAs affecting their stability [PMC9226514]. The downregulation of SNORD83B can affect mRNA targets by modulating their steady-state levels [PMC8162545]. LIGR-seq identified multiple novel interactions between SNORD83B and mRNAs as well as its function in controlling mRNA levels [PMC8969105][PMC5389715][PMC7140444][ PMC9644009][ PMC6248267][ PMC7038934].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGUUCAGUGAUGAGGCCUGGAAUGUGCGCUGGGCACAGCGCCCGAGACAGACUGCGGAACCGUUCCUUGUUGCCUUCCUUCUGAGAACAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications