Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-302c-3p URS000027080C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-302c: Hsa-mir-302c is a microRNA that has been predicted to bind to the rs10204525 polymorphic site in the 3' UTR of PD1 mRNA with allele G, according to bioinformatics analysis [PMC4662465]. It is part of a group of microRNAs that act together to regulate the expression of specific genes, such as ETS1, ESR1, and MYC [PMC6176299]. In various studies, hsa-mir-302c has been found to be upregulated in different contexts [PMC4268797]. For example, it was upregulated in hepatocellular carcinoma and acted as a tumor suppressor by inhibiting angiogenesis [PMC4434893]. It was also found to be highly expressed in two iPSC-RPE cell lines compared to hfRPE cells [PMC5070511]. In colon cancer cells, hsa-mir-302c was downregulated compared to normal cells [PMC9941246]. Additionally, hsa-mir-302c was identified as a differentially expressed miRNA in atrial fibrillation and myocardial infarction groups [PMC8629660]. In various experiments, hsa-mir-302c has been manipulated using miRNA mimics or short hairpin structures against its gene [PMC9497224]. For example, it was overexpressed using a short hairpin structure against its gene in lentiviral vectors [PMC4100019], and its expression was downregulated by H2O2 treatment [PMC6884596]. Overall, hsa-mir-302c plays diverse roles in different biological contexts [PMC6884596].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGUGCUUCCAUGUUUCAGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Publications