Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 91B (SNORD91B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 91B (SNORD91B) URS0000269B1D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD91B: SNORD91B is a C/D box snoRNA that has been found to be upregulated in hepatocellular carcinoma (HCC) [PMC7461500]. It has also been shown to be upregulated in the plasma of HCC patients compared to healthy donors [PMC9818347]. SNORD91B has a high degree of identity to its mouse ortholog Gm22771 [PMC5032015]. In some targets, methylation was reduced by more than 50%, including SNORD91B [PMC8336889]. However, there is no evidence indicating upregulation of snoRNA expression, including SNORD91B, in PDAC development [PMC6360365]. It is associated with bone mineral density in the femoral neck [PMC10097643].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGAGCCAAUGAUGUUUUUAUUCAAAAUGUCUGAACCUGUCUGAAGCAUCCCAGUGAUGCAACUUCUGUGUGAUACUGAGGCUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications