Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548l URS0000260A3A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548l: Hsa-mir-548l is a significant miRNA that is common to both datasets [PMC8742548]. In a study, cell lines were transfected with hsa-mir-548l mimic or inhibitor, along with other miRNA mimics and inhibitors, and harvested 48 hours post-transfection [PMC9671919]. The expression of hsa-mir-548l was quantified and normalized to RNU6B using the Livak method [PMC9671919]. In another study, a tag SNP tagging a mature hsa-mir-548l variant was found among the SNPs located in miRNA genes [PMC4229095]. Hsa-mir-548l was also identified as one of the miRNAs affected by rare CNVs in CAKUT [PMC9587983]. Additionally, hsa-mir-548l was found to be involved in regulating genes associated with RASopathies [PMC6863982]. Heterozygous variants were identified in hsa-mir-548l in one patient [PMC6863982]. The rs13447640 variant is located in the 5' arm of hsa-mir-548l [PMC6863982]. Hsa-mir-548l was also associated with certain pathways according to TargetScan and IPA analysis [PMC5429229]. The rs1050955 polymorphism was predicted to be located near target binding sites for several miRNAs including hsa-miR-300, hsa-miR-381, and hsa-mir-548l according to bioinformatics tools [PMC3432110]. However, expression levels of hsa-miR-300, hasmiR381, haslet7f1*, haslet7a*, and hsal et7a* were low or absent compared to PAI1 and miR421 which were highly expressed [PMC3432110].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGUAUUUGCGGGUUUUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-548l
Publications