Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-664a-5p URS0000259AE4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-664a: Hsa-mir-664a is a miRNA that has been validated and associated with a model of carcinogenesis [PMC6485221]. It is one of the three miRNAs, along with hsa-miR-150 and hsa-miR-483, that have been shown to be deregulated during the carcinogenesis process [PMC6485221]. Expression levels of hsa-mir-664a were found to be similar between tumor-adjacent samples and samples without tumor tissue [PMC6485221]. However, hsa-mir-664a was exclusively downregulated in tumor-adjacent samples compared to antrum without tumor tissue [PMC4496000]. Hsa-mir-664a is one of the miRNAs that mainly participated in defining component 2 in a study on sPLS components [PMC8698767]. It was also observed that the record of snoRNA gene SNORA36B overwrote the record of the overlapping miRNA gene hsa-mir-664a in cases where two ncRNA genes overlapped in the same region [PMC3675212]. In summary, hsa-mir-664a is a validated miRNA associated with carcinogenesis and its expression levels have been found to be deregulated during this process. It has been shown to be downregulated in tumor-adjacent samples compared to antrum without tumor tissue. Hsa-mir-664a also plays a role in defining sPLS components. However, its record can be overwritten by overlapping snoRNA genes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGCUAGGGAAAAUGAUUGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications