Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-378c URS000025307A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-378c: Hsa-mir-378c is a miRNA that has been identified as a potential prognostic biomarker for TA treatment in patients with migraine without aura (MWoA) [PMC9871901]. In a study comparing miRNAs in placenta and plasma, it was found that hsa-mir-378c, along with hsa-mir-1246 and hsa-mir-203a-3p, are known to play a role in the pathophysiology of preeclampsia (PE) [PMC9601722]. However, hsa-mir-378e has not been identified as a potential biomarker for PE [PMC9601722]. These findings suggest that hsa-mir-378c may have diagnostic and prognostic value in the treatment of MWoA and could potentially be used as a biomarker for PE. Further research is needed to validate these findings and explore the mechanisms by which hsa-mir-378c contributes to these conditions.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGACUUGGAGUCAGAAGAGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications