v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-371a-5p URS000025282C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-371a: Hsa-mir-371a is a novel p53-regulated miRNA identified in hepatocellular carcinoma (HCC) [PMC4757586]. It is one of the miRNAs selected to create a miRNA-mRNA network in HCC [PMC8872348]. It has been included in a prognostic model for survival prediction in HCC patients [PMC9264898]. Hsa-mir371a has also been found to be downregulated in primary and metastatic colon cancer cells [PMC9941246]. It is encoded by chromosome 19 and cleaved by Dicer ribonuclease [PMC9011302]. Additionally, it has been associated with breast cancer according to the database dbDEMC2 [PMC7929672].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUCAAACUGUGGGGGCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Equus caballus eca-miR-371-5p
  2. Macaca mulatta mml-miR-371-5p
  3. Pongo pygmaeus (Bornean orangutan) ppy-miR-371-5p
 Publications