Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-758-3p URS000024B619_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-758: Hsa-mir-758 is a microRNA that has been studied in various contexts. It has been analyzed in osteosarcoma (OS) patients, where it was found to have low expression and poor prognosis [PMC9553349]. In another study, it was identified as one of the miRNAs that were down-regulated in etoposide-resistant MCF7 cells [PMC3445463]. Additionally, hsa-mir-758 was found to be co-downregulated with other miRNAs (hsa-miR-512, hsa-miR-660, hsa-miR-1304, hsa-miR-30d, hsa-miR-33a, hsa-miR-337, and hsa-miR-1277) [PMC9428793]. The biological processes affected by these differential miRNAs were investigated through GO and KEGG enrichment analyses [PMC9428793]. Interestingly, it has been experimentally proven that hsa-mir-758 is a translational regulator of the WWOX gene [PMC4763216]. Overall, these studies highlight the potential role of hsa-mir-758 in various biological processes and its association with different diseases.

mRNA interactions 7 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUGACCUGGUCCACUAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus (cattle) bta-miR-758
  2. Canis lupus familiaris cfa-miR-758
  3. Capra hircus chi-miR-758
  4. Cavia porcellus cpo-miR-758-3p
  5. Dasypus novemcinctus dno-miR-758-3p
  6. Echinops telfairi Ete-Mir-154-P26_3p (mature (guide))
  7. Equus caballus (horse) eca-miR-758
  8. Gorilla gorilla gorilla ggo-miR-758 (MIR758)
  9. Gorilla gorilla ggo-miR-758
  10. Pan troglodytes ptr-miR-758
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-758
  12. Pteropus alecto pal-miR-758-3p
  13. Rattus norvegicus (Norway rat) rno-miR-758-3p
Publications