Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-885-5p URS0000246356_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-885: Hsa-mir-885 is a microRNA that has been studied in various contexts. It has been found to exhibit an inverse association with hsa-miR-424 in modulating the expression of CALM genes [PMC6682788]. Hsa-mir-885, along with hsa-miR-424 and hsa-miR-29c, is involved in the regulation of genes belonging to the CALM family [PMC6682788]. In glioblastoma (GBM) and Alzheimer's disease (AD), hsa-mir-885 is differentially expressed, with upregulation in GBM and downregulation in AD [PMC6682788]. Hsa-mir-885 is also upregulated in the complement score-high group, indicating its potential role as a tumor suppressor miRNA [PMC9828444]. It has been identified as a prognostic miRNA along with other miRNAs such as hsa-mir-421, hsa-mir-495, hsa-mir-194-2, and hsa-mir-30d [PMC9598836]. Although its direct relationship with low-grade glioma (LGG) has not been investigated yet, existing studies suggest an association between hsa-mir-885 and LGG based on its expression in cancer cells [PMC9598836]. Hsa-mir-885 has also been found to be overexpressed in patients with primary osteoarthritis [PMC5728069]. In terms of cytokine and chemokine correlation analysis, there is a good correlation between hsa-miR326 and IL6, as well as between hsa-miR15b and IL6. HSA-MIR 885 also shows correlation to IL15. It also shows positive correlation to influenza B infection but negative correlation to influenza A infection. In breast cancer cells, hsa-mir-885 directly targets B7-H3, suggesting its role in modulating B7-H3 protein expression [PMC6749327].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAUUACACUACCCUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus (cattle) bta-miR-885
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-885
  3. Canis lupus familiaris cfa-miR-885
  4. Dasypus novemcinctus dno-miR-885-5p
  5. Equus caballus eca-miR-885-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-885-5p
  7. Oryctolagus cuniculus ocu-miR-885-5p
  8. Pongo pygmaeus (Bornean orangutan) ppy-miR-885-5p
  9. Pteropus alecto pal-miR-885-5p
  10. Sus scrofa (pig) ssc-miR-885-5p
Publications