Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small Cajal body-specific RNA 2 (SCARNA2) secondary structure diagram

Homo sapiens (human) small Cajal body-specific RNA 2 (SCARNA2) URS000023DE4C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA2: SCARNA2 is a small Cajal body-specific RNA (scaRNA) that is involved in regulating DNA-PK activation [PMC8866460]. In the absence of SCARNA2, an abnormal DNA-PK complex is formed, which also contains elevated amounts of LINP1, a long non-coding RNA (lncRNA) that facilitates interaction between Ku80 and DNA-PKcs [PMC8866460]. SCARNA2 is upregulated in colorectal cancer (CRC) and is associated with poor prognosis [PMC9490904]. Among the 11 candidates studied, SCARNA2 was expressed in endothelial cells [PMC9630315]. The 3' region of SCARNA2 has been previously studied for its role in the formation of full-length SCARNA2 [PMC7648615]. The efficiency of the non-homologous end joining (NHEJ) repair process was enhanced in cells lacking SCARNA2, indicating its role in regulating this repair pathway [PMC8866460]. Processing assays with purified coilin showed that scaRNA 2 and 9 generate processed fragments when incubated with coilin [PMC4395269]. RRM2 was found to be essential for TDP-43 binding to scaRNA9 and contributed to some extent to binding to SCARNA2 or SCARNA28, but had almost no contribution to binding scaRNA7 [PMC6412121]. The 161 bp region upstream of mature SCARNA2 contains sufficient information for Pol II transcription of the gene, while the mature 3' end has been mapped to position +420 of the gene [PMC2811027].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUUUAGGGAGGGAGAGCGGCCUGGGUCCUGGGUGUUGUGUGCGGAGCUGUGGCGUCGCGUGUGAGGCGCGUGCAGGGUGAGUGUGAGUGGACGCGUGAGUGUGUGAGUGUGCGCGCUUGGAGCGUGUUAGGCGAGUGCGUGCGCCCACCCCUGCGCCCCUCCUCCCGCUUACACUUUGAUCUUAUUUGAUCGGAUCGUGACCCCAGCCCCGCCGGGCCGACCCGAAAUGAAAAGCUCUCCUCCUGCGAAGCCCCCUCGGGGCGCUGUGCAGCGAGGCCCCUUAGGCGGCGGCCACGCUGUGGUCCCCGAGGUCCCGGAGCUGGCCCUGCGGGGCCCGGCGCUCAGAAGUGAUGAAUUGAUCAGAUAGACGAGGCCGGGCUUGUCCCCGGCCACUGAUUAUCGAGGCGAUUCUGAUCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications