Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-26a precursor (hsa-mir-26a-1) URS000023C301_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR26A1: MIR26A1 is a microRNA that has been implicated in various biological processes and diseases. It has been found that the rs7372209 T allele in MIR26A1 is associated with an increased risk of endometriosis, while the reference C allele is protective against endometriosis development. However, these associations were not significant after Bonferroni correction [PMC5363543]. In aggressive chronic lymphocytic leukemia (CLL), downregulation of EZH2, a gene involved in cell survival, is induced by overexpressing MIR26A1. This suggests a pro-survival role of EZH2 in aggressive CLL and an indirect effect of MYC reduction on the levels of negative regulators such as MIR26A1 [PMC6773411]. In CLL patients, there is a negative correlation between the expression of EZH2 and its negative regulators like MIR26A1 [PMC6773411]. Additionally, MIR26A1 has been found to be hypermethylated and silenced in CLL patients, leading to higher levels of EZH2 [PMC5652802]. It has also been shown that MIR26A1 can regulate TET1 at the transcriptional level by modulating the levels of EZH2 at the TET1 promoter [PMC5652802]. Overall, these findings highlight the role of MIR26A1 in various diseases and its interaction with genes like EZH2 and TET1.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGUUACUUGCACGGGGACGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000013494.1)
  2. Castor canadensis miRNA (ENSCCNG00000022199.1)
  3. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000018771.1)
  4. Chlorocebus sabaeus microRNA 26a-1 (ENSCSAG00000025587.1)
  5. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000012651.1)
  6. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-26a (ENSGGOG00000029851.2)
  7. Gorilla gorilla microRNA ggo-mir-26a precursor
  8. Lagothrix lagotricha microRNA lla-mir-26a precursor
  9. Macaca fascicularis (Crab-eating macaque) microRNA 26a-1 (ENSMFAG00000004405.2)
  10. Macaca mulatta microRNA mml-mir-26a precursor (mml-mir-26a-1)
  11. Macaca nemestrina mne-mir-26a (ENSMNEG00000016928.1)
  12. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000009604.1)
  13. Marmota marmota marmota (Alpine marmot) microRNA 26a-1 (ENSMMMG00000011262.1)
  14. Microcebus murinus (gray mouse lemur) microRNA 26a-1 (ENSMICG00000019452.3)
  15. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 26a-1 (ENSNLEG00000022213.2)
  16. Pan paniscus microRNA ppa-mir-26a precursor
  17. Pan troglodytes (chimpanzee) microRNA ptr-mir-26a precursor (ptr-mir-26a-1)
  18. Papio anubis miRNA (ENSPANG00000016533.3)
  19. Piliocolobus tephrosceles miRNA (ENSPTEG00000022009.1)
  20. Pongo abelii miRNA (ENSPPYG00000022085.2)
  21. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-26a precursor
  22. Prolemur simus microRNA 26a-1 (ENSPSMG00000015322.1)
  23. Propithecus coquereli miRNA (ENSPCOG00000010341.1)
  24. Pteropus vampyrus microRNA 26a-1 (ENSPVAG00000027083.1)
  25. Rhinopithecus bieti miRNA (ENSRBIG00000017113.1)
  26. Rhinopithecus roxellana microRNA 26a-1 (ENSRROG00000026838.1)
  27. Saimiri boliviensis boliviensis microRNA 26a-1 (ENSSBOG00000005383.1)
  28. Sciurus vulgaris (Eurasian red squirrel) microRNA 26a-1 (ENSSVLG00005025262.1)
  29. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000006330.1)
  30. Theropithecus gelada microRNA 26a-1 (ENSTGEG00000019619.1)
Publications