Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-124 precursor (hsa-mir-124-2) URS000023AB58_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR124-2: MIR124-2 is a locus that is frequently methylated in HPV DNA testing. The methylation status of MIR124-2 is analyzed using the QIAsure Methylation Test [PMC10095339]. This test is performed at enrollment and also in follow-up specimens [PMC5338782]. MIR124-2 is the most frequently methylated locus in both the initial testing and follow-up specimens [PMC5338782]. The QIAsure Methylation Test by Qiagen is a reliable method for analyzing the methylation status of MIR124-2 [PMC10095339]. This test, along with HPV DNA testing using HC2 and full HPV genotyping by Anyplex II HPV28 Detection Kit, provides comprehensive information about the presence of HPV and methylation status of MIR124-2 [PMC10095339]. The use of these tests at enrollment allows for early detection and monitoring of HPV infection, as well as identification of methylated loci such as MIR124-2 [PMC5338782]. The frequent methylation of MIR124-2 suggests its potential as a biomarker for HPV infection and its progression [PMC5338782]. Further research can explore the clinical implications and potential therapeutic targets associated with the methylation status of MIR124-2 in HPV infection.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAAGAUUAGAGGCUCUGCUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGCGGAGCCUACGGCUGCACUUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications