Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7i-3p URS0000237CBD_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-let-7i: Mmu-miR-155 and mmu-let-7i have been well-documented in T cells [PMC4099493]. Mmu-miR-487b-5p and mmu-miR-214-3p were classified into the same group as mmu-miR-155 and mmu-let-7i, respectively, after hierarchical clustering [PMC4099493]. Acads is a putative target of mmu-miR-27a, mmu-miR-215, and mmu-let-7i [PMC3692539]. The upregulation of members of the let-7 family, including mmu-let-7a-5p, mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7f-5p, mmu-let-7g-5p, and mmu-let-7i-5p, is associated with liver regeneration [PMC9198802]. The let-7 family is highly represented in miRNA profiles, with eight members from mmu-let-7a to mmu-let-7i [PMC3668261]. Mmu-let-7g and mmu-let-7i are in the same cluster as mmu-let-7b [PMC3937077]. Five members of the Let-7 family, including mmu-let-7a, mmu-let-7b, mmu-let-7c, mmu-let-7f, and mmu-let-7i, are dysregulated in response to obesity and weight reduction following LFD feeding [PMC4571067]. Mmu-let-7i is one of the upregulated miRNAs validated using qRT-PCR in liver tissues from the CCl4 group and control group mice [PMC4926493].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCGCAAGCUACUGCCUUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-let-7i-3p
  2. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-let-7i
  3. Capra hircus chi-let-7i-3p
  4. Cavia porcellus cpo-let-7i-3p
  5. Cervus elaphus cel-let-7i-p3
  6. Chrysemys picta cpi-let-7i-3p
  7. Columba livia (rock pigeon) cli-let-7i-3p
  8. Dasypus novemcinctus dno-let-7i-3p
  9. Homo sapiens hsa-let-7i-3p
  10. Oryctolagus cuniculus ocu-let-7i-3p
  11. Python bivittatus (Burmese python) pbv-let-7i-3p
  12. Rattus norvegicus rno-let-7i-3p
  13. Sus scrofa (pig) ssc-let-7i-3p
  14. Taeniopygia guttata (zebra finch) tgu-let-7i-3p
Publications