Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1908-5p URS00002373FD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1908: Hsa-mir-1908 is a microRNA that has been observed to be upregulated in diabetic fracture samples [PMC7288911]. The MiRWalk and miRanda databases predict that hsa-mir-1908 regulates the gene EXO1 [PMC7288911]. Survival analysis has shown that hsa-mir-1908 is significantly associated with the survival rate of patients [PMC4247319]. Additionally, hsa-mir-1908 has been implicated in cancer susceptibility in human populations [PMC4159108]. In a study of grade III and IV glioma patients, hsa-mir-1908 was found to be downregulated [PMC4247319]. It should be noted that hsa-mir-1908 was excluded from a study examining miRNA expression levels in various conditions [PMC8107736]. Inhibition of hsa-mir-1908 has been shown to affect the expression levels of NF2 in SH-SY5Y cells [PMC4951313].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGCGGGGACGGCGAUUGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications