Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-181a precursor (hsa-mir-181a-1) URS000022682F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR181A1: MIR181A1 is a gene located on chromosome 1q32.1 [PMC4342183]. Previous findings and current data suggest a new mechanism of action for the ETV6/RUNX1 fusion gene, in which it binds to the regulatory region of MIR181A1, resulting in low expression of hsa-mir-181a-1 [PMC4651427]. This binding reduces the miR-181a-mediated translational repression of ETV6/RUNX1. An intergenic SNP, rs427790, located between MIR181A1 and NR5A2, is an expression quantitative trait locus (eQTL) hit in the testis and basal ganglia [PMC6071032]. Blocking MSK1 activation or knockdown also reduces STAT3 recruitment at the MIR181A1 promoter [PMC4666837]. Analysis identified a 10-gene set of downregulated genes predicted to be bound by MIR181A1 or miR181b1, including NEXMIF, DEK, DTX4, FBXO33, MEAF6, MED8, MFSD6, PLEKHJ1, RBBP7 and SCOC [PMC7108928]. Overexpression of both MIR181A1 and miR181b enhanced growth in 3D cultures compared to single miRNA overexpression [PMC7108928]. Additionally, MIR181A1 amplification was found in approximately 12% of breast cancer samples [PMC4666837]. The expression of both members of the Mir181ab cluster (MIR181A1 and Mir18b) is necessary for inducing an oncogenic phenotype in KRAS-mutated tumors [PMC7108928].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUCAAAACCAUCGACCGUUGAUUGUACCCUAUGGCUAACCAUCAUCUACUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Publications