v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-26b-3p URS000021C6A8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-26b: Hsa-mir-26b is one of the 7 candidate miRNAs that were selected for further validation after comparing them with those screened by GEO [PMC7478658]. Previous studies have reported that hsa-mir-26b, along with hsa-miR-16, is stable in various human tissues and cell lines [PMC3418238].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCUGUUCUCCAUUACUUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Macaca mulatta (Rhesus monkey) mml-miR-26b-3p
  2. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8115896
  3. Pteropus alecto (black flying fox) pal-miR-26b-3p
  4. Sus scrofa (pig) ssc-miR-26b-3p
 Publications